Abstract: Generative artificial intelligence has become the focus of the intelligent education field, especially in the generation of personalized learning resources. Current learning resource ...
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Abstract: Reliable and efficient trajectory generation methods are a fundamental need for autonomous dynamical systems. The goal of this article is to provide a comprehensive tutorial of three major ...